Anti-LexA | LexA repressor (protein, positive control)

Produktübersicht

• Artikelname: Anti-LexA | LexA repressor (protein, positive control)
• Artikelnummer: AGR-AS21-4541P
• Hersteller Artikelnummer: AS21-4541P
• Alternativnummer: AGR-AS21-4541P
• Hersteller: Agrisera
• Kategorie: Proteine/Peptide
• Applikation: WB

Produktbeschreibung

Escherichia coli LexA protein inhibits the transcription of the genes belonging to the SOS regulon that are related to DNA repair and cell division by recognizing and binding to the SOS-box sequence (TACTGTATATATATACAGTA). LexAs self-protease activity is

Produkteigenschaften

• Molekulargewicht: 22,3 | 23 kDa
• UniProt: P0A7C2
• Reinheit: Contains 50% glycerol, 10 mM Tris-HCl (pH 7,5), 2 mM EDTA, 100 mM NaCl, 1 mM DTT. Over 90 % pure by SDS-PAGE.
• Formulierung: Liquid
• Antibody Type: Secondary Antibody

Anwendungsbeschreibung

• Anwendungsbeschreibung: LexA protein is full length, highly purified (over 90 %, SDS-PAGE) provided at a concentration of 1 mg/ml estimated by BCA method. UniProt: P0A7C2