IONIS-MAPTRx, CAS [[2857842-32-9]] Preis auf Anfrage

Produktübersicht

• Artikelname: IONIS-MAPTRx, CAS [[2857842-32-9]] Preis auf Anfrage
• Artikelnummer: TGM-T73992
• Hersteller Artikelnummer: T73992
• Alternativnummer: TGM-T73992-5MG,TGM-T73992-50MG
• Hersteller: TargetMol
• Kategorie: Biochemikalien
• Alternative Synonym: LY2409881

Produktbeschreibung

IONIS-MAPTRx (BIIB080) is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx has the potential for the research of Alzheimer Disease [1] . ( MCE IONIS-MAPTRx for murine use [3] : Tau ASO-12 sequence - 5' GCTTTTACTGACCATGCGAG 3' )

Produkteigenschaften

• Molekulargewicht: 7182
• CAS Nummer: [2857842-32-9]