Anti-LexA | LexA repressor (protein, positive control)

Catalog Number: AGR-AS21-4541P
Article Name: Anti-LexA | LexA repressor (protein, positive control)
Biozol Catalog Number: AGR-AS21-4541P
Supplier Catalog Number: AS21-4541P
Alternative Catalog Number: AGR-AS21-4541P
Manufacturer: Agrisera
Category: Proteine/Peptide
Application: WB
Escherichia coli LexA protein inhibits the transcription of the genes belonging to the SOS regulon that are related to DNA repair and cell division by recognizing and binding to the SOS-box sequence (TACTGTATATATATACAGTA). LexAs self-protease activity is
Molecular Weight: 22,3 | 23 kDa
UniProt: P0A7C2
Purity: Contains 50% glycerol, 10 mM Tris-HCl (pH 7,5), 2 mM EDTA, 100 mM NaCl, 1 mM DTT. Over 90 % pure by SDS-PAGE.
Form: Liquid
Antibody Type: Secondary Antibody
Application Notes: LexA protein is full length, highly purified (over 90 %, SDS-PAGE) provided at a concentration of 1 mg/ml estimated by BCA method. UniProt: P0A7C2