IL-2RB/CD122, Bacteria

Catalog Number: NBS-BT-2ZJ672-1
Article Name: IL-2RB/CD122, Bacteria
Biozol Catalog Number: NBS-BT-2ZJ672-1
Supplier Catalog Number: BT-2ZJ672-1
Alternative Catalog Number: NBS-BT-2ZJ672-1
Manufacturer: Nordic BioSite
Host: Bacteria
Category: Proteine/Peptide
Interleukin-2 (IL-2) is a T cell stimulatory cytokine best known for inducing T cell proliferation and NK cell proliferation and activation. IL-2 also promotes peripheral development of regulatory T cells (Tregs) . Conversely, IL-2 is involved in the act
Concentration: 0.5mg/ml
Molecular Weight: ~26kDa
Tag: His-tag
UniProt: P14784
Buffer: PBS, 4M Urea, PH7.4
Source: bacteria
Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).
Sequence: GCAGTGAATGGCACCAGTCAGTTCACCTGCTTCTATAATAGTCGTGCCAATATTAGTTGTGTGTGGAGTCAGGATGGCGCACTGCAGGATACCAGTTGCCAGGTTCATGCCTGGCCGGATCGCCGTCGTTGGAATCAGACCTGTGAACTGCTGCCGGTGAGTCAGGCAAGTTGGGCATGTAATCTGATTCTGGGCGCCCCGGATAGTCAGAAACTGACCACCGTTGATATTGTTACCCTGCGCGTTCTGTGCCG