DNMT Substrate-1

Product Overview

• Article Name: DNMT Substrate-1
• Biozol Catalog Number: SCM-D53-58
• Supplier Catalog Number: D53-58
• Alternative Catalog Number: SCM-D53-58-105
• Manufacturer: SignalChem
• Category: Sonstiges

Product Properties

• Molecular Weight: The size of double-stranded oligonucleotide is 34 base pairs. The molecular weight is 20891.54.
• Source: The synthetic double-stranded oligonucleotide (Sense: 5- GATCCGACGACGACGCGCGCGCGACGACGAGATC, Anti-sense: 5- GATCTCGTCGTCGCGCGCGCGTCGTCGTCGGAC) is used as a substrate for DNA methyltransferase 3A (DNMT3A).