IONIS-MAPTRx, CAS [[2857842-32-9]] Preis auf Anfrage

Product Overview

• Article Name: IONIS-MAPTRx, CAS [[2857842-32-9]] Preis auf Anfrage
• Biozol Catalog Number: TGM-T73992
• Supplier Catalog Number: T73992
• Alternative Catalog Number: TGM-T73992-5MG,TGM-T73992-50MG
• Manufacturer: TargetMol
• Category: Biochemikalien
• Alternative Names: LY2409881

Product Description

IONIS-MAPTRx (BIIB080) is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx has the potential for the research of Alzheimer Disease [1] . ( MCE IONIS-MAPTRx for murine use [3] : Tau ASO-12 sequence - 5' GCTTTTACTGACCATGCGAG 3' )

Product Properties

• Molecular Weight: 7182
• CAS Number: [2857842-32-9]